EST details — SGN-C35738

Search information 
Request: SGN-C35738Match: SGN-C35738
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C35738Clone name: cLEG-36-B2
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEG-36-B2.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255738Length: 330 bp (912 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E255738 [] (trimmed) TGCNCTAAGCGTAACGAGATGCTGCACAAAGTGAGAAACCAGAGCCTGTCAAGACTCATCTGAGGAACATGATTATTGTTCCTGAGATGAATTGG
GAGTGTCATTGGGATTTACAATGGGAAGAACATTCAATCAGATCGAGGTCAAGCCTGAGATGATTGGCCACTATCTGGCTGAGTTCTCAATATCA
TACAAGCCTGTCAAGCATGGAAGACCCGGTATTGGTGCTACTCACTCATCAAGGTTCATTCCTCTGAAGTAATATGGGATGTTAGGTTATCTCGT
GCTGTCTTTTGCTACAATTTTGATGTAGGTCTTCGATTATGAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255738] SGN-U581490 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T71021 [Download] [View] Facility Assigned ID: TBFFN01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0242 Quality Trim Threshold: 14.5