EST details — SGN-C36089

Search information 
Request: SGN-C36089Match: SGN-C36089
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C36089Clone name: cLEG-37-I19
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEG-37-I19.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E256162Length: 594 bp (770 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E256162 [] (trimmed) CAAGACGCAGCAGATAAATTGGTTCAGATGTTGGATCTTGCACCACCTGGAAAACAGGAAGTGTTATCACCTGACTTCACACCTAATCCTGTTCT
AGAGCGTTACTACCGCTATCTTAACCTGAAGTCAAAGCACCCAGATGCAGCTGTTCCTCCACTTGATGAAACCCTCAGAAAGATAACAGAACCTG
ATGTTGAACTTCTTTCTCAAAACAAGTCCATCATAGAGGAACTCCGTAGGTCTTTTGAACTAAAAGATAATCCAAAGCTGAAAAAATCAGCAAGA
AGAATAAAAGAGAGACCTTCAGGATCAGATGAGGAGATAGAAGAATTCAACAAAGATGCTGATGTCAAAGCTATAGACTCCATGGAATACTCAGC
CAAAACAGAAGTTGAGAAAGTTGGAGATGTTAATCCTGTCAAAGACTTTGAGGATATGGCTGTCTCGAAGAGATAATCCAAAATGGATTAGTAAG
GCCATTCAGGATATGAAAAATAGGATCTTTGATCTCGTCGAAAATTCTTGTGACGGAGATACATTTCATAAAGCATTGCAATGTTTGGTGGCTCT
ACGCAAAGGTTGCATCCTTGAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E256162] SGN-U579721 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T70646 [Download] [View] Facility Assigned ID: TBFFO58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5