EST details — SGN-C4517

Search information 
Request: SGN-C4517Match: SGN-C4517
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C4517Clone name: cLEC-27-E17
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEC-27-E17.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204073Length: 555 bp (787 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E204073 [] (trimmed) TCGGCACCAAGAGCGAGCACCTATTGACCTGGTCACAGTTCTAGATATTAGTGGCAGCATGGCTGGATCAAAATTGACTCTCTTGAAACAAGCAG
TTTGTTTTGTCATAGATAACTTGGGTCCTTCTGACCGGCTATCTATTGTTACCTTTTCATCAGGAGCTCAAAGAAACTTTCCCTTGCGAAGGATG
ACAGAACAAGGGCGTAGAGAGGCTGCACAGGCTGTCAATGCCATTTCAGCAAATGGTGGCACAAATATCGTGGAAGGACTCAAGAAGGGGGTTCG
GGTTCTTGAAGAAAGACGTGAAAGGAACCCAGTTGCAAGCATTATTCTCTTGTCAGATGGGAGAGACACCTTTAACGGTGATATCGCCAACCAAC
GGCGGAGTCCTCGGAACCGCAGATCCTCTAATGCAACCTCAGGTCCCGACTTTCTGAATCTATTGCCTTCTTCCATTTGTCCTCGCAATAGAGAA
GGACTAGCAGCAGGACAGCAGCCAACTTTCCATGTACATACGTTTGGATTTGTTTAGACCATGATTCCTCTGCTATGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204073] SGN-U566524 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28807 [Download] [View] Facility Assigned ID: TCAEA33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0125 Quality Trim Threshold: 14.5