EST details — SGN-C45984

Search information 
Request: SGN-C45984Match: SGN-C45984
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C45984Clone name: cLEI-10-F11
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEI-10-F11.
Additional sequencing 
Clone: SGN-C189032 [TUS-56-L22] Trace: SGN-T338775 EST: SGN-E537900 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189032 [TUS-56-L22] Trace: SGN-T348843 EST: SGN-E547968 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E264984Length: 653 bp (916 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E264984 [] (trimmed) AGAAAGTGGGTCAATGACCAGAGTATTAATGAAGTCTTGTTTCTCTTGCGGGGATGATCCAAGCCAGATTCCTGAAGAGCCTCCTCAAAATTCTG
TGAAGTACCTGACATGGCATCGTACCACATCATCTCATGCTTCATCCCCAAATCGGCATGGTGTAAACTCCACAGATGGTATTGAGGATGTTTCC
AACAATCTCTTCGATAACTTTTGTATGGTCTCAGGAAGTCATGCCTCTACGTTGGATCGGCTGTTTGCATGGGAGAAAAAGCTATATGACGAAGT
CAAGGCTAGTGAGATGATCCGAAGTGATTATGATGCTAAGCGTAAGCTTCTCCGACAACTAGAATCTAAGGTAGAGACTCCTCAGAGGATCGACA
AGACGCGTGCTGTTGTGAAGGATCTTCATTCGAGAATTGGAGTTGCAATTCATAGAATTAATTCCATCTCTAGGAAAATTGAAGAAATAAGAGAC
AAGGAACTTCAGCCTCAATTGGAGGAGTTGATTGAGGGATTGAGGAAGATGTGGGAAGTTATGTTCGACTGCCACAAGCTTCAGCTCCATATCAT
ATCGATAGCTCATTCGCCTGGAAATATGAAGATCCTTATTCAATCAGATTCTCGTCGGCAGATTGCAATCCATCTTGAACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E264984] SGN-U586373 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T81823 [Download] [View] Facility Assigned ID: TGSBM30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5