EST details — SGN-C4716

Search information 
Request: SGN-C4716Match: SGN-C4716
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C4716Clone name: cLEC-28-O23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEC-28-O23.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205407Length: 398 bp (946 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E205407 [] (trimmed) CAAATAGAACTGTATATAATAAAAATGGCTTCTCGTAGCTTTCTCTTTATTTATGTGTTAGTCATGTTTTGTCTAGCAGGCATGGCGTTTTCGGA
GTTGTCCGATGATTTCTACCACCATATTTGTCCCAAAGCTTTACCAACCATTAAACGGGTTGTTGTGGATGCAGTCAGAAAAGAGAGACGAATGG
GTGCTTCTTTGCTACGTTAACATTATCATGATTGTTTCGATAACGGTTGTGATGCTTCGATTCTCCTTGACCAAACTTCTACCATTAATAGTGAA
AAGACTTCTCGTGCTAATAACAATTCTGCTAGAGGATTTGAGGTGATTGATAAAATTAAATCAGAGGTTGATAAAGCTTGTGGACGTCCGGTTGT
ATCTTGTGCTGACATCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205407] SGN-U576375 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28894 [Download] [View] Facility Assigned ID: TCAEE96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0183 Quality Trim Threshold: 14.5