EST details — SGN-C62866

Search information 
Request: SGN-C62866Match: SGN-C62866
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C62866Clone name: cLEM-23-E21
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEM-23-E21.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271630Length: 603 bp (994 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271630 [] (trimmed) GGTAGCTTCCATTTCTTTTGGCGAAGATGTCTGTTAAGGTTCTGAATGCAAATGCAGAGGTGCTCAATAAATCTGCGGCGCTTCACATGAACATC
AACGCCGCCAAGGGTTTACAGGATGTTCTAAAGACAAATCTTGGTCCTAAAGGAACCATCAAGATGCTTGTTGGTGGTGCTGGTGACATTAAGCT
TACCAAGGATGGTAATACATTGTTGAAAGAGATGCAAATTCAGAACCCAACTGCAGTAATGATTGCTAGGACTGCTGTAGCTCAAGATGATACTA
GTGGGGATGGTACTACGTCTACTGTGCTTTTCATTGGGGAGCTCATGAAACAATCTGAACGATGCATAGATGAAGGGATGCATCCTCGTGTGCTA
GTGGATGGTTTTGAAATTGCAAAAAGAGCAACTCTACAATTTCTTGAAAAATTTAAGACTCCTGTAGTAATGGGTAACGAGCCAGATAAAGAGAT
ATTGAAGATGGTTGCAAGAACGACATTGAGAACAAAGTTGTATGAGTCACTGGCTGATCAGCTGACTGACATTGTTGCAAATTCTGTGCTCTGCA
TTCGCAAGCCTGATGAAGCTATTGATCTTTTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271630] SGN-U576925 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T87158 [Download] [View] Facility Assigned ID: TGFDK35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5