Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C646

Search information 
Request: SGN-C646Match: SGN-C646
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C646Clone name: cLEB-7-J7
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEB-7-J7.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200120Length: 618 bp (843 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E200120 [] (trimmed) CTCTTATCACCACCGCCCTCTAAGTTCAAGCCTTACCCATTTTCGCCGCTTCCCCGAGCAGTTCATAGACAGGGGAGAAGCACTCAAACAACGAA
AAATGTAAATTCCTTGTCTTGTACTTCAATGACAACAAAAATTGGCGTTGTTAACAAGTGGAATTGTTATGGACTGGAAGGAAAAGTTAGATTTA
GCAGAAGAGTAATGCTAATGCCAATCGTGAATGCAGCAGTGACGCAGCCTGTATCAGAAAATGAAAGAGAATCGAACTTTAAGAGGATTCTTCTT
TCTGATGTAGTCGTGACCCGGCCTAGGGATGTGCTTTGGGGAAGGAAATGGAATTCAATGGATATGGCCTCAGCTGCGGTGGTGGTGTCTATGCA
TTTGCTCTGTCTATTTGCACCCTTTACTTTCAATTACGCTGCTCTTGGGATTGCATTTGGGTTATATGTAATCACTGGACTTCTCGGTATTACAC
TTTCTTTTCACAGAAACCTCTCTCATAGAAGTTTCAAACTTCCCAAATGGCTTGAATACTTTTTTGCCTATTGTGGTGTCCAAGCACTTCAGGGA
CATCCAATTGATTGGGTGAGTACTCATAGGTACCACCATCAGTTTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200120] SGN-U569117 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22692 [Download] [View] Facility Assigned ID: TSHBA52THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5