EST details — SGN-C65766

Search information 
Request: SGN-C65766Match: SGN-C65766
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C65766Clone name: cLEN-11-F24
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEN-11-F24.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E274644Length: 653 bp (908 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E274644 [] (trimmed) CAAAAATATTATGGACAGCATGGTCCTCGGAATGCTTGCTGAGCAGTTGGGAGAACTAAAACTTGGAGAGCTGTTGGACACTCCTCCACCTGGTC
TGGATGAGGCTATTGCAATTTCAAAGGTCATGCAATTTCTTGAATCAAAGGAGTATAGTGCCTTCTCTCGCATAGTTTTTGATACAGCACCAACG
GGGCACACACTTAGACTACTATCGCTCCCAGACTTCTTGGATGCATCAATAGGCAAGATGATGAAGCTTAAAAAGAAAATAGCATCAGCTACTTC
AGCTTTAAAATCCATGTTCAACAAAGGGGAGCCACAACGAGATGATGCTAGTGACAAGCTAGAGCAATTAAGGGAGAGGATGGCAAAAGTTCGAG
ATCTGTTCCGTGATTCAGAAACTACAGAGTTTATCATTGTGACAATCCCCACTGTGATGGCGATCAATGAGTCTTCACGACTCTGTGCATCATTG
AAGAAGGAAAGTGTTTCAGTAAGAACGCTCATCGTTAACCAAGTCCTACCTCCGTCTACATCAGAATGCAAGTTCTGTGTGATGAGAAGAAAGGA
TCAGATGCGTGCTCTTGAAACTATCACTAAAGATCCCGAGTTAGCAAGTTTAAAGATAATCCAAGCACCATTGGTTGATGTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E274644] SGN-U583069 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T89671 [Download] [View] Facility Assigned ID: TRRBR36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5