Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-C69316

Search information 
Request: SGN-C69316Match: SGN-C69316
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C69316Clone name: cLEN-9-M1
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEN-9-M1.
Additional sequencing 
Clone: SGN-C189546 [TUS-58-B8] Trace: SGN-T339575 EST: SGN-E538700 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189546 [TUS-58-B8] Trace: SGN-T339578 EST: SGN-E538703 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E275083Length: 555 bp (862 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E275083 [] (trimmed) AAAAGACCAGTGAAAGTTTGTATGACCAGAAGCCCGAAGAACCGCCTGTTCAAGTTTCTTCCTCCAACCCTGCAAGTAGAGCACCAACTGGTGGC
TCATCATTCACATCTCGCTTCGAGTACACGGACAATGTCCAATCCTCTGAGATGAGTTCTGGACGTGTTCTTAACCATGTATCCCCTCCAATGTC
CTCCAATTTTTTTGCGGACTATGGAATGGAAAGCGGTTTCACAAAGAAAAGCTCAAAATCTTCCAAAGTTCAAATCGAGGAAACTGATGATGCAA
GGAAGAAGTTTACTAATGCAAAAGCAATTTCATCTGCCCAATTCTTTGGTGATCAGAGCAAAGCTGAAATGGAAGCCTCAGTTTCTCTTAAGAAG
TTCTCGGGTTCAAGTGCCATATCAAGTGCAGACCTTTTTGGTGACGATGATAGATCAGATTTGGACCTCACTGCTGGTGATCTCATTAACCGGAT
CTCATTCCAGGCACAACAGGACATGTGCTCTCTGAAAAACATGGCTGGAGAAACTGGAAAGAGACTTGGCTCATTTGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E275083] SGN-U582607 Tomato 200607 Build 2 51 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88955 [Download] [View] Facility Assigned ID: TRRBG73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5