EST details — SGN-C69406

Search information 
Request: SGN-C69406Match: SGN-C69406
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C69406Clone name: cLER-10-C13
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLER-10-C13.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278646Length: 417 bp (832 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E278646 [] (trimmed) CACGACTGTGTTGTCCAAGTGAGCAAAGGTAGTTGCAGGGGCAGGATCTGTCAAGTTATCATCAGGCACATACATAGTCTGGACAGATGTAATAT
AACCTTTCTTGGATGTAGTGATACGCTCTTGAAGACCTCCAAGATCTGTAGCCAAAGTTGGTTGATAACCGACAGCAGATGGGATACGACCAAGC
AAAGCAGAGACCTCTGAGTTAGCCTGGGTAAATCTGAAAATGTTGTCAATAAAGAGAAGCACATCCTGCCCCTCAGCATATTTGAAGTGCTCAGG
CACAGTCAATCCTGTAAGGCCAACACGGGCACGAGCACCAGGGGGCTCATTCATTTGACCATATACAAGAGCGCACTTGCTTTCACTTTGCTTTT
CACCTAGCTTAATAACACCACTTTCAATCATTTCCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278646] SGN-U585664 Tomato 200607 Build 2 85 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94073 [Download] [View] Facility Assigned ID: TPRBK19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0316 Quality Trim Threshold: 14.5