Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-C70348

Search information 
Request: SGN-C70348Match: SGN-C70348
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C70348Clone name: cLER-14-H18
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLER-14-H18.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E281701Length: 503 bp (919 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E281701 [] (trimmed) CTAAGATGAGCTCAACGAGAACAGAAATCTCGTGTGGAACAGAAGGGTAAAAGCTCGTTTGATTCTGATTTCCAGTACGAATACGAACCGTGAAA
GCGTGGCCTAACGATCCTTTAGACCTTCGGAATTCGAAGCTAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCAGCCAAGCGTT
CATAGTGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAATTCACCAAGTGTTGGATTGTTCACCCACCAATAGG
GAACGTGAGCTGGGGTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGACAGTGTCGCAATAGTAATTCAACCTAGTACGAGAGGAAC
CGTTGATTCACACAATTGGCCATCGCGCTTGGTTGAAAAGCCAGTGGCGCGAAGCTACCGTGTGCTGGATTATGACTGAACGCCTCTAAGTCAGA
ATCCGGGCTAGAAGCGACGCATGCGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E281701] SGN-U581066 Tomato 200607 Build 2 266 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94960 [Download] [View] Facility Assigned ID: TPRCD45THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.992 Expected Error Rate: 0.0009 Quality Trim Threshold: 20.5