Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-C72198

Search information 
Request: SGN-C72198Match: SGN-C72198
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72198Clone name: cLER-1-H17
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178552 is on microarray TOM1: SGN-S1-1-3.4.4.14
This clone has been mapped as cLER-1-H17.
Additional sequencing 
Clone: SGN-C178552 [TUS-29-H6] Trace: SGN-T184199 EST: SGN-E371432 Direction: 3' Facility: INRA
Clone: SGN-C178552 [TUS-29-H6] Trace: SGN-T184200 EST: SGN-E371433 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280397Length: 403 bp (725 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280397 [] (trimmed) CAGACATAGTAAGGATTGACAGACTGAGAGCTCTTTCTTGATTCTATGGGTGGTGGTGCATGGCCGTTCTTAGTTGGTGGAGCGATTTGTCTGGT
TAATTCCGTTAACGAACGAGACCTCAGCCTGCTAACTAGCTATGCGGAGGTATCCCTTCGCGGCCAGCTTCTTAGAGGGACTACGGCCTTTTAGG
CCGCGGAAGTTTGAGGCAATAACAGGTCTGTGATGCCCTTATATGTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGCTTATAGCCT
TGGCCGACAGGCCCGGGTAATCTTTGAAATTTCATCGTGATGGGGATAGATCATTGCAAGTGTTTGATGTGTTCCCTCTGGAAGAGCTTTTTCTT
TTGATATGGTGCAATAGGTAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280397] SGN-U581028 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91951 [Download] [View] Facility Assigned ID: TPRAC45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0130 Quality Trim Threshold: 12.5