EST details — SGN-C7531

Search information 
Request: SGN-C7531Match: SGN-C7531
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C7531Clone name: cLEC-39-E5
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C182466 is on microarray TOM1: SGN-S1-1-1.3.8.15
This clone has been mapped as P41.
Additional sequencing 
Clone: SGN-C182466 [TUS-39-K8] Trace: SGN-T199397 EST: SGN-E398071 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208476Length: 283 bp (1034 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E208476 [] (trimmed) CAGACTGAACCCAAAACGACGATTGCGAAGTCTTCTTTTGTCTTCTCCATCAACAGCAACTTTTTTGCCCCTCTCTCTCTCGATCGAAAAATTCC
TCCATTGATTTGTTCTTCTGCTTCTTCTCGTGAATGAAATTTCTCTGAGAGAGGAAGTAGAGAGAGAGAGAGAGAGTGAGTGTGTGTGTGTGAGA
GAGATCGGCGATGGGGAGAGGTAAGATAGTGATAAGGAGGATCGATAATTCGACGAGCAGGCAAGTGACGTTCTCGAAGAGGAGAAATGGATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208476] SGN-U576309 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31766 [Download] [View] Facility Assigned ID: TCAFW27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0152 Quality Trim Threshold: 14.5