EST details — SGN-C75978

Search information 
Request: SGN-C75978Match: SGN-C75978
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C75978Clone name: cLES-16-G15
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185639 is on microarray TOM1: SGN-S1-1-4.3.9.5
This clone has been mapped as cLES-16-G15.
Additional sequencing 
Clone: SGN-C185639 [TUS-47-O13] Trace: SGN-T197767 EST: SGN-E396441 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288241Length: 621 bp (832 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E288241 [] (trimmed) TGAAGTTACTGCTAAGTATAAACCTCCTATAATGCCAATTGGTAAAGGTGCTTATGGAATCGTTTGTTCTGCTTTGAATTCGGAGACAAATGAAT
CTGTAGCAATTAAGAAAATTGCTAATGCTTTTGATAACAAGATTGATGCTAAGAGGACTTTGAGAGAGATCAAGCTTCTTCGACATATGGATCAT
GAAAATATTGTTGCGATCAGAGATATAATTCCACCACCACAGAGAGAAGCCTTTAACGATGTTTACATTGCGTATGAGCTTATGGATACTGATCT
CCATCAAATTATTCGCTCGAATCAGGGTTTATCTGAGGAGCACTGCCAGTATTTCTTGTATCAGATCCTCCGTGGGTTGAAATACATACATTCTG
CAAATGTTTTGCACAGAGACTTAAAGCCTAGCAATCTTCTCTTGAATGCCAACTGTGATTTGAAGATATGTGATTTTGGGCTAGCTCGTGTCACT
TCTGAAACTGACTTTATGACCGAATATGTTGTGACAAGATGGTATCGTCCACCTGAGCTGTTGTTGAATTCATCCGACTATACTGCAGCAATTGA
TGTATGGTCAGTGGGTTGCATCTTCATGGAGTTGATGGACAGAAAACCCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288241] SGN-U576603 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100967 [Download] [View] Facility Assigned ID: TPSCI44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5