Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-C78406

Search information 
Request: SGN-C78406Match: SGN-C78406
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C78406Clone name: cLES-5-J1
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185463 is on microarray TOM1: SGN-S1-1-4.4.10.20
This clone has been mapped as cLES-5-J1.
Additional sequencing 
Clone: SGN-C185463 [TUS-47-H5] Trace: SGN-T192612 EST: SGN-E391286 Direction: 3' Facility: INRA
Clone: SGN-C185463 [TUS-47-H5] Trace: SGN-T197667 EST: SGN-E396341 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285661Length: 473 bp (789 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285661 [] (trimmed) TTTTCGAGGACCAAGCAAGGCCTTATCAACAAGACCGCCTCACTCCCTCCCATATTGTATTACAACTTACAAGATTGAACAAACAGCTCAGACGC
TACCAATAAACTGTTCCATCTTATAGGTGGTGTAAATTTCAAGGCAAAGACGCTGTGGCACGAATCCCCTATTTGTAGAGTAAAATGAGTGCCTT
GGATGCAGCCAGAGCAGAGCTTGCCCTTGCAGTCTTGTACTTGAACAAAGCAGAGGCAAGGGACAAGATATGCAGGGCAATACAGTATGGTTCAA
AATTTGTGAGTAATGGAGAGCCTGGCACTGCTCAAAATGTTGACAAATCAACTAGCTTAGCAAGGAAAGTATTCCGTCTTTTCAAGTTCATCAAT
GATCTGCACGGGCTTATTAGTCCACCTGCCCCAGGAACCCCACTTCCACTCATCTTGTTGGGGAAGTCTAAAAATGCATTGCTATCGACTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285661] SGN-U568462 Tomato 200607 Build 2 62 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98144 [Download] [View] Facility Assigned ID: TPSAS49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5