EST details — SGN-C8075

Search information 
Request: SGN-C8075Match: SGN-C8075
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C8075Clone name: cLEC-4-E12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEC-4-E12.
Additional sequencing 
Clone: SGN-C167746 [TUS-1-E24] Trace: SGN-T448 EST: SGN-E379865 Direction: 3' Facility: Avesthagen
Clone: SGN-C167746 [TUS-1-E24] Trace: SGN-T1226 EST: SGN-E379462 Direction: 5' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201475Length: 618 bp (931 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201475 [] (trimmed) GCAAATATATCTTCCTTCTTAAGAAGGCTTAGTCAATAAGATATATCACATATCTTTTCTATAGTGTGCCAATAAGATCTTAAGAGGATTGTGGT
GTGTGCTTTTCTCATCCATACTTGCAATTCTTGTGTCTTGAGTACGATGGCGGATCGAGTATATCCTATGGATTTACCATCATCATCAAGTAATC
CACCGTCTTCAAACAACTCCGGCGAAGTAGTTTCACCGAAAAAACCATCATTTCCATCTCCGGCGAAACCTATACAACCTCCGGCGGGGACTTAC
GTAGTTCAAGTTCCGAAGGATCAAATTTACAAGTATCCTCCACCGGAGAATTCTCGCCGGTATGAGTCGCTTACTAAACGGAAACCTCGCCGGAG
CTGCTGCTGTCGTTGTCTCTGCTTCACTTTCTCTGTTCTACTTTTTCTCATTATATCAATCGGAATCACCGCCGGAGTTCTCTTCCTTGTTTACC
GTCCTGAAGCACCAAAATACACCATTTCCAGCATCGCGATTAAGAATTTCAACGTCACGTCGTCGTCTAAGATCTCGCCGGAGTTTGACATTTCT
GTCAGATCTGAAAACCCGAATAACAAATTAGGGATTTACTACCGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201475] SGN-U572224 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24425 [Download] [View] Facility Assigned ID: TCAAN30THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5