EST details — SGN-C82295

Search information 
Request: SGN-C82295Match: SGN-C82295
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C82295Clone name: cLET-1-I13
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179474 is on microarray TOM1: SGN-S1-1-1.2.2.14
This clone has been mapped as cLET-1-I13.
Additional sequencing 
Clone: SGN-C82295 [cLET-1-I13] Trace: SGN-T102571 EST: SGN-E292297 Direction: 3' Facility: TIGR
Clone: SGN-C179474 [TUS-31-N16] Trace: SGN-T185602 EST: SGN-E373464 Direction: 3' Facility: INRA
Clone: SGN-C179474 [TUS-31-N16] Trace: SGN-T185603 EST: SGN-E373465 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292107Length: 638 bp (868 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292107 [] (trimmed) TTTTTTCAGCAGGACTATTTCGCGGTATCTCTCCTCTCTCGAGTATCACAATAGTGGTAGAATAGAATTAAGAAGGAAGGATGCTCTCAGTGTTC
AACATGGGAGCTCAGCTTCAACCAAGAGTAATAGGCCTTCCCAGAAGTCAAGGTGTATTGGATGTAGAAGTATATTCTATAAATAGAGCACAACT
GAGGACTTCCACCAGCAACAGATTTATGTGCACATTAAATCAGTCAACAGGAGTCTCGGCTCAAGCAGCACAAACAGAAAGTAGGACTTTAGTCA
AAATGTGTGGAATTACATCAGCTAGAGATGCTGCTCTTGCAGCAGAAGCTGGAGCCAATTTTATTGGTATGATCATATGGCCCAACTCAAAGCGC
TCTGTTTCACTTTCTACTGCAAAGGAAATCTCAAAGGTTGCGCGGGAATATGGAGCTCTTCCAGTTGGGGTGTTTGTAGATGATAATGCTAACAC
AATACTAAGGGCCTCTGATGCAGCAAACCTTGAATTGGTGCAGGTGAAGACTGTTATCTTTCACCATCTTGTATCTATTGTTTTCAATACTCAAA
ATCCACAACATGTTCAAATTGAGCAGCTTCATGGAAATGATTCTCGAGATGCTTTTCCAGTTTTAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292107] SGN-U564371 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102381 [Download] [View] Facility Assigned ID: TMEAA55THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0026 Quality Trim Threshold: 14.5