EST details — SGN-C87499

Search information 
Request: SGN-C87499Match: SGN-C87499
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C87499Clone name: cLET-4-N7
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLET-4-N7.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289641Length: 306 bp (889 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E289641 [] (trimmed) CTCCAGATTTCGAAGAGAGGAAGAAGCAATAATGGATGTAATCAAATCTCAGCAAATATCTTCGAGGCCGATTGAGAAGGTAATTGTTCACCCGC
TTGTGCTTTTGAGCATCGTAGACCACTACAATAGAGTTGCAAGAGACACAAGGAAACGTGTTGTTGGGGTTTTGCTTGGAACTTCGTTTAAAGGC
ACTGTTGATGTTACTAATAGCTATGCAGTGCCCTTTGAGGAGGAGGAGAGGGACCCTAGTATCTGGTTTCTTGACCATAACTATCATGAATCGAT
GTTTTCCATGTTCCGTAGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289641] SGN-U578650 Tomato 200607 Build 2 53 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103312 [Download] [View] Facility Assigned ID: TMEAO76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0135 Quality Trim Threshold: 14.5