EST details — SGN-C87614

Search information 
Request: SGN-C87614Match: SGN-C87614
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C87614Clone name: cLET-5-E4
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLET-5-E4.
Additional sequencing 
Clone: SGN-C190684 [TUS-61-A18] Trace: SGN-T341530 EST: SGN-E540655 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190684 [TUS-61-A18] Trace: SGN-T341533 EST: SGN-E540658 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290206Length: 329 bp (418 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290206 [] (trimmed) CAGGCATACAGGGAGCCAGGCATGCTCAATTTGGAGTACCTTTATTGGATCTTCACCTTAGCAACAAATTACCGTCAGGACTGTTACCACCAAGT
TTCCAGCGCGTTGCAGCCAACTCACAACTTCCTAATGTCATCAATAAGTGCCAAAATGACAGAAATGATAACATCTCTTGTTTGCTTACAATGGG
TACTTCAAGTAAGACATTGGACAAAAATGATAGTGTGAATACACCTCGGTTCTTACTCTTCGGTCAGCCAATTCTGACTGAGCAACAAATCTCTA
ATGGATGTTCTGTCAGTGCTCCACAAGTAGTCCAAACAGGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290206] SGN-U563944 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103654 [Download] [View] Facility Assigned ID: TMEAR26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0168 Quality Trim Threshold: 14.5