EST details — SGN-C87652

Search information 
Request: SGN-C87652Match: SGN-C87652
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C87652Clone name: cLET-5-G20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLET-5-G20.
Additional sequencing 
Clone: SGN-C190689 [TUS-61-A23] Trace: SGN-T341539 EST: SGN-E540664 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190689 [TUS-61-A23] Trace: SGN-T341541 EST: SGN-E540666 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290216Length: 720 bp (879 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290216 [] (trimmed) AAAATGGGACAAGTGCAGAGCGAAGCCATTGATAATCAATCGAAATCTACATCTGTTGATGATTCTCAGCCGCGTTCTCTCGATTCTTTGATTGC
TGAAGCTGCAGCATATGGTGAAGACGGTGAGAATGAGTCCATTGACGAGAAAGCTCGGAAAGCTCTAGAATGTCCTTGCATTGCTCATTTGCGCG
CTGGCCCTTGCGGCAACCAGTTCTCAGACGCTTTCCTCTGTTTCCTCAAGAGCACAGCTGAAGAAAAGGGCTCTGACTGCGTTAGTCCCTTTGTC
GCTCTTCAAAGCTGCATCAAGGCAAATCCTAATGCATTTTCAAAGGACGTCCTGGACGAGGAAGATGATGTCAGGAAACAAGATGAAGTCAAGAC
GGAAGAAACACAAAAACAAGAATATAGAATCATCCCTCCTATTTGGTCTGTAGAATCAAAGAATACTAAGCGTACTAAGCTCTAGAAGACTGATC
ATTAACCTTCGTTTATTTGTTCTTCCATTCTTGGAAGCCCTGGCCTGGTAGTACAATACCAATTACTACTACAGTAACTAGCAGAGTACTGCCAG
AAAAATCTTTTCCCTTCTGATCTGCATGATCAAAACTTTNTAAGTTCATTAGCATGGAACTATAGACACTAGACCAAAGCTTCTAGTAAAAGCTT
AGATTGATTCAAATTTTCATGTTATTACCTACTTTTCAGGGTTTTGGTTATTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290216] SGN-U572463 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103664 [Download] [View] Facility Assigned ID: TMEAR46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0079 Quality Trim Threshold: 12.5