EST details — SGN-C88151

Search information 
Request: SGN-C88151Match: SGN-C88151
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C88151Clone name: cLET-7-D17
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLET-7-D17.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291851Length: 494 bp (894 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E291851 [] (trimmed) CAAATCTCTTATAGAAGAAGAAGATCTAAAGGATCTACAGAACTTTCTAGAAGAAAATGGAGTGTGTGTTCGGAATGGTCGGTAACGGTTTCTCA
CTGGTGGTAGCGGACTCCTCCGCCGTGCACAGTATATTGGTTCACAAATCTAATGAAGACAAAATCATGATTCTCGATTCGCATAAACTTATGGG
AGCGAGTGGTGAAGCTGGAGACAGAGCCCAGTTTACGGAGTATGTGCAGAAAAATGTGGCTTTGTATCAGTTTCGTAATGGTATTCCGTTGACTA
CAGCTGCTACGGCTAATTTTACAAGAGGCGAGCTAGCTACAGCTTTGCGTAAGAATCCATACATGGTGAACATTATCCTGGCTGGATATGACAAG
GGGACAGGCCCTTCTCTATATTACATTGATTATATTGCTACTCTGCACAAGGTGGATAAAGCAGCGTTTGGTTATGGCTCCTATTTCTCTCTTGC
CATGATGGATAGGCACTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291851] SGN-U569603 Tomato 200607 Build 2 46 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104104 [Download] [View] Facility Assigned ID: TMEBA21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5