EST details — SGN-C88492

Search information 
Request: SGN-C88492Match: SGN-C88492
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C88492Clone name: cLET-8-G3
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLET-8-G3.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291051Length: 540 bp (902 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E291051 [] (trimmed) GAAAACTCGATTCCACTTTATCTCTCTGAATTGGACTCAGAGAGAGAGAGGGAGGAAGGAGGAAGAAGAGTTGTTTAAGCTTTTGGATTTTTTGT
TATTGGGTTTATAGAAATCTTCGACATTGAGAATGGATCAGATATTGAACAAAGTGGGTTCTTACTGGATAGGTAAAAGAGCCAACAAGGAGATC
AATTCCGTCGGCGATGACATTAATTCATTGCAAAGCAGCATTGAAGGAGGAACCAAGTGGCTAGTGAACAAGCTTAAAGGAAAAATGCAAAAGCC
ATTGCCAGATCTTCTGAAGGAATATGATGTTCCAGTAGGTATTTTTCCTCGTGATGCCACCAATTACGAGTTCAATGAAGAAACACGAAAGCTCA
CAGTCTTTATACCCTCTGTATGTGAAGTTGGCTACAAGGATTCATCTGTATTGCGCTTCTCTACAGCTGTTACTGGATATCTGGAAAAAGGAAAG
CTAGTCGAGATTGAAGGAATGAAAACAAAGGTGATGGTGTGGGTAAAAGTTACTGCCATCTCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291051] SGN-U571921 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104447 [Download] [View] Facility Assigned ID: TMEBC38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5