Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-C89563

Search information 
Request: SGN-C89563Match: SGN-C89563
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C89563Clone name: cLEW-17-O12
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEW-17-O12.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300232Length: 345 bp (831 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E300232 [] (trimmed) GCTAAACCATAATACAGGGTCTGGGTATGGTGCACCTGAGGTAGCTATGTATGGGCAATGCACCATAAAAAGTGATGTCTACAGCTTTGGAGTTG
TTATGTTGGAACTTCTTACCGGACGAACACCTTTTGATAGTGAGAGACCAAGATCTGAACAATCTTTAGTTAGATGGGCAACACCTCAACTCCAT
GATATTGATGCCTTGGCTAAGATGGTTGATCCAGCACTTAAAGGACTCTATCCTGTTAAATCTATTTCGCGCTTTGCTGATGTAATTGCTCTTTG
TGTCCAGTCTGAGCCTGAGTTCCGGCCACCTATGTCAGAAGTTGTTGAAGCCTTAGTTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300232] SGN-U571990 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T113280 [Download] [View] Facility Assigned ID: TRDCN90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0356 Quality Trim Threshold: 12.5