Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-C91178

Search information 
Request: SGN-C91178Match: SGN-C91178
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C91178Clone name: cLEW-26-E14
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as P68.
Additional sequencing 
Clone: SGN-C191981 [TUS-64-G19] Trace: SGN-T343764 EST: SGN-E542889 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191981 [TUS-64-G19] Trace: SGN-T343765 EST: SGN-E542890 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302904Length: 629 bp (925 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E302904 [] (trimmed) TTTTCGAGGAAGGAAAGTAGTATTAGAAAAGTCGGGGAGAAATCAATGCTCTTCATTTTTTTCCCCCTTTTTCTAAACTAGGGTTTCTATAACAA
CAACTATTTGTGTCTTCACTCTATTATAATTTAACTTATAAAGTTTTTTCTAATTTCTTTTTCTCTTCATCTTTCAGATCTAAGAAACCATAAAG
TTTTTATTTTTAGGGGTTATTATCCACTTCAAGATTTAGAATCTTTCTATTTTTGGAAACTTCTCATGAATTGGTGGAAAGAGGATATTTCTGAA
GGACGTCTAATACGTTAAGGGCATTTTTTCGCGAAGAAGAAAATGGTGAGGGGAATAACTGAGATGAAAAGGATTGAAAATACAACAAGTAGACA
AGTGACATTCTCAAAAAGAAGAGGTGGACTACTTAAGAAGGCATTTGAACTCTCAGTTCTTTGTGATGCTGAAGTTAGTCTCATCATATTTTCTC
AAAAAGGAAAACTTTTTGAGTTTTCAAGTTCAAGTACTAACAAGACAATAGAACGTTATCAAAAGAATGACAAGAATTTGGGTCATGAAAATATA
TTACTTGAACAAACTACAAAGCATTTGAAGGGGGAGGTTATGAGCATGACTAGGAATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302904] SGN-U572195 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T114736 [Download] [View] Facility Assigned ID: TRDDX31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5