EST details — SGN-C91293

Search information 
Request: SGN-C91293Match: SGN-C91293
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C91293Clone name: cLEW-26-M16
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEW-26-M16.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302923Length: 666 bp (918 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E302923 [] (trimmed) GCCAATGTGCTCCTGAAGATAAACGCGAAGCTTGGAGGTTTGAACTCTATGTTAACTGTTGAACATTCTCCTGCAATCCCTATGGTGTCTAAGGT
CCCTACCATTATTCTTGGGATGGATGTGTCCCATGGCTCTCCTGGCCAATCTGATGTCCCTTCAATTGCAGCGGTTGTCAGTTCAAGGCAGTGGC
CATCAATATCTCGTTACAGAGCTTCAGTTCGTACTCAGTCTCCTAAAGTGGAGATGATAGACAACTTGTTTAAACGTACCTCTGATACTGAAGAT
GATGGAATAATGAGGGAGGCGTTGCTAGATTTTTATGTGAGCTCTGGAAAAAGGAAGCCCGAGCATATAATAATATTCAGGGATGGTGTCAGTGA
ATCTCAGTTTAGTCAAGTTCTGAATGTTGAGCTGGACCAGATTATTGAGGCTTGTAAGTTTCTTGATGAGAAGTGGTCACCCAAGTTTGTGGTGA
TAGTTGCCCAGAAGAACCATCATACCAAGTTTTTCCAGCCTAATGATCCTAACAATGTTCCTCCAGGCACAATCATAGACAACAAAGTCTGTCAC
CCAAGGAATTATGACTTTTACCTGTGTGCTCATGCTGGAATGATTGGTACAACTCGTCCTACTCACTATCACGTCTTGTATGATGAGCTGGGTTT
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302923] SGN-U577343 Tomato 200607 Build 2 106 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T114755 [Download] [View] Facility Assigned ID: TRDDX80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5