EST details — SGN-C93042

Search information 
Request: SGN-C93042Match: SGN-C93042
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C93042Clone name: cLEX-13-I15
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEX-13-I15.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306285Length: 498 bp (1076 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E306285 [] (trimmed) GCTCACATCTCAGTTTGTTTTGAGAAGTACAGGGAAGGGTTAGCAGTTAGCACTCTGAAACATTTTTTTATGAGATAAGGAATTTCATTAAATGA
CATCATGAAGTGTCAGCTCCAACTTCATCTTGGGTATTCTGCAGTAAAGAAAAAAATGTCACGAAGGTATGATAGCCGAACAACAATCTTCTCCC
CAGAAGGTCGTCTCTACCAAGTTGAGTACGCAATGGAGGCTATTGGAAATGCAGGTAGTGCTATAGGCATCTTGTCCAAGGATGGGGTGGTGTTG
GTAGGTGAAAAGAAAGTTACATCTAAGCTGCTTCAGACCTCTACTTCAAGTGAGAAGATGTACAAGATCGATGATCATGTGGCATGCGCTGTAGC
TGGAATTATGTCTGATGCCAACATTCTGATCAACACAGCCAGGTTTCAGGCTCAGCGCTATACGTTCGCTTATCAAGAACCCATGCCAGTTGAGC
AACTTGTCCAGTCACTATGTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306285] SGN-U568670 Tomato 200607 Build 2 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117378 [Download] [View] Facility Assigned ID: TRXBW56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0016 Quality Trim Threshold: 14.5