Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-C93659

Search information 
Request: SGN-C93659Match: SGN-C93659
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C93659Clone name: cLEX-15-F2
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: Alias clone SGN-C182530 is on microarray TOM1: SGN-S1-1-1.1.7.3
This clone has been mapped as P61.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305490Length: 574 bp (887 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E305490 [] (trimmed) GTCTCTATCTATGCTAGGTAGCTTATATGATTTAATAGTTCGATTAATTTAAATACGCATTAAAGATAGAGGATGGGAAGAGGTAGGGTAGAGTT
GAAACGGATCGAGAACAAAATAAGCAGACAAGTAACATTCTCAAAGAGACGATCTGGATTATTGAAGAAAGCTAATGAGATCTCAGTATTATGTG
ATGCTGATGTTGCATTGATTGTGTTTTCTACCAAAGGCAAACTTTTCGAGTATTCCTCAAATGACTCAAGTATGGAAAGTATTCTTGAAAGATAT
GAAAGATGCTCATATGCAGAGAGACAGATGAATGCTAATGATTCTGATCCCAAGGAAAATTGGAGTGTGGAGTATCCGAAGCTCATGTCAAGAAT
TGAACTTTTACAAAGAAATATAAGGCATTACATGGGTCAGGATCTGGACCCTCTCAGTTTGCGTGAGCTCCAGAGTATAGAGCAACAGATTGATA
CTTCATTAAAGAGAATTAGAAGCAGGAAGAATCAACTGATGCACGAGTCCATTTCTGAGCTGCAGAAAAAGGAGAAAGCGCTCCAAGAACAAAAC
AACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305490] SGN-U583377 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117976 [Download] [View] Facility Assigned ID: TRXCH25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5