EST details — SGN-C94063

Search information 
Request: SGN-C94063Match: SGN-C94063
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C94063Clone name: cLEX-2-F13
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEX-2-F13.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303504Length: 388 bp (504 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E303504 [] (trimmed) GCTCTGACTTCCCTCCTTCCCCATTTCAAAACCCTAACCCTAGTTTCCCGCAGAGGACAAAATGTTGGAACTACGTCTTGTTCAGGGAAGTCTGC
TGAAGAAAGTTCTAGAATCGATTAAGGATCTGGTGAACGATGCGAACTTTGATTGTTCCGCCACTGGATTCTCTCTGCAAGCCATGGACTCCAGT
CACGTGGCTCTGGTGGCGCTGCTGCTCCGATCTGAGGGTTTTGAGCACTATCGTTGTGACCGGAACATTTCAATGGGCATGAACCTTACTAACAT
GGCGAAAATGCTCAAATGTGCTGGAAATGATGACATCATCACCATCAAGGCTGACGATGGCAGTGACACCGTCACTTTCATGTTAGAAAGCCCCA
CCCAAGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303504] SGN-U566397 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115592 [Download] [View] Facility Assigned ID: TRXAG31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5