EST details — SGN-C94129

Search information 
Request: SGN-C94129Match: SGN-C94129
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C94129Clone name: cLEX-2-I9
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEX-2-I9.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303464Length: 650 bp (850 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E303464 [] (trimmed) TACAAACAGTTCTAAGAGAGATATGGATCGGGTTAAAGGTCCATGGAGCCCTGAAGAAGATGAGCTTTTACAGCAACTTGTTCAGAAACATGGCC
CGAGAAATTGGTCTCTAATAAGCAAATCGATTCCGGGGAGATCCGGAAAATCTTGCCGCTTGCGGTGGTGTAATCAGTTATCTCCACAGGTGGAG
CATCGGGCTTTTACGCCTGAAGAAGATGAGACTATTATTCGGGCTCATGCCCGATTCGGTAACAAATGGGCTACTATAGCCCGACTTCTTAATGG
GCGGACTGATAACGCTATTAAGAATCACTGGAACTCTACCTTGAAGAGGAAGTGTTCATCGCTTAGTGCCGATGAAGGGAACGAACTCGCCGATC
AACTTTTTGAGAATCAGCAGCCGCCGTTGAAGAGATCTGTTAGTGCCGGATCCGCTATGCCGGTTACTGGTTTTCATTTCAGTCCGGGTAGCCCG
TCGGGTTCTGATAGCGATTCGAGCCTTCATGTTACGTCGTCGTCCCAATCTCAAGTGTTTAAGCCTGTTGCCAGAACCGGCGGCGTATTTCCGCC
GTCGATTGATATTTCATCTCCGCCTGTTGATCCTCCCACTTCTCTAAGCCTTTCGCTTCCTGGTGTTGACTTGGCTGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303464] SGN-U569474 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115552 [Download] [View] Facility Assigned ID: TRXAE53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.992 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5