EST details — SGN-C95112

Search information 
Request: SGN-C95112Match: SGN-C95112
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C95112Clone name: cLEX-8-I24
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: Alias clone SGN-C184834 is on microarray TOM1: SGN-S1-1-1.1.14.18
This clone has been mapped as cLEX-8-I24.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E301429Length: 552 bp (699 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E301429 [] (trimmed) GCCGCCCCTTGGATTCTTACGGTAGGCGCCAGCACTACTGATAGAAAGATAAAAGTTACTGTTACACTTGGAAATACAGAGGAATTTGAAGGGGA
AGCTTCTTATCGTCCACAGATTTCCGACTCAAAATTCTTCACTCTGTATGATGCTTCAAAAGGTAAAGGTGATCCATCTAAAACCCCTTACTGCA
AACCAGGGTCACTCACTGACCCTGCAATAAAAGGAAAGATAGTCATATGTTATCCAGGTGTCGTTTCTAAGGTTGTAAAAGGACAAGCTGTGAAG
GATGCTGGAGGTGTTGGTATGATTGCCATCAACCTGCCAGAAGATGGTGTCACAAAATCAGCTGATGCTCATGTTCTTCCAGCTTTGGAGGTTTC
AGCTGCAGATGGAATCAGAATTCTTACTTATACAAACTCAATATCAAACCCTACAGCTAAAATCACATTCCAAGGAACAATAATTGGAGATGAAA
ACGCTCCCATAGTTGCTTCATTTTCTTCTCGCGGACCAAATAAACCTAGTCCTGGCATCTTGAAACCTGACATAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E301429] SGN-U577371 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115956 [Download] [View] Facility Assigned ID: TRXBD60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5