EST details — SGN-C95862

Search information 
Request: SGN-C95862Match: SGN-C95862
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C95862Clone name: cLEY-13-J2
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEY-13-J2.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306133Length: 585 bp (877 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E306133 [] (trimmed) TGTCCGAAGCTGTGCGGTTTGCGGTGGCGGCGCTGCTCATCTTCAACGGCAAAAAGATGGAAATCAAGGCAGATGGAAGTGATGGATCATTGGTT
TTAATCAAGCAAGGAGCTGAAGCTAGGGTATTTGAGTCAACATTTGTGGGTAGTAGAAGGTGTATTATCAAAGAACGGTTTTCAAAGAAATACAG
GCATCCGATTTTGGACTCAAAGCTCACTCTTAAACGGTTGAATGCGGAAGCAAGGTGCATGACAAAAGCTAGACGGCTTGGTAGTTGTCACTCCA
GTGTTGTATGCTGTTGACACTGTTATGCACACTCTCACCTTTGAATATGTTGAAGAGTCTTCGGTGAAAGATATATTGCTTGGCTTTGGACTAGT
TGGAGTTGACGAAGAACGAATGGCTGATATTACAACACAGATTGGTAATGCTATTGGAAAACTACACGATGGTGGCCTAGTCCATGGCGATTTGA
CAACATCAAACATGTTACTGAGGAGTTCTGCCAATCAGCTGGTGCTGATTGACTTTGGTCTAAGCTTTACTTCAACGCTTCCAGAAGATAAAGCA
GTTGATTTATATGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306133] SGN-U571193 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119311 [Download] [View] Facility Assigned ID: TRYBZ49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0120 Quality Trim Threshold: 14.5