EST details — SGN-E115866

Search information 
Request: SGN-E115866Match: SGN-E115866
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C58005Clone name: cLEL-35-I22
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C58005 [cLEL-35-I22] Trace: SGN-T15701 EST: SGN-E230618 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E115866Length: 927 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 3'
>SGN-E115866 [] (called/trimmed by facility)
TGAAAATCTGATCGACTCTACCCACCTTTTTTTTTTNATAATATCACCAAAAAAATAATACACATTGGGGAAATTTAAAATGTATCATACCCCTA
AAAACACACCAAAATAAATCATTACAATATATCAACCATATTAATAATACTCCACCCCCTATAATTTTAAACCTACTTTTACAAAACATCCATAT
ATTCCATAAAATTCATCAATTATTTAATACTATTCTAATATCCCTAATCATTATCCACCACTCAATACAACCCTACTAAAAATCTTCTTAAATTA
TCAATCTATTTTACAATTTCTTAATAATATAACAACTCTCTTTAAAACAAATTCTATATTAAATCTAAAAATTTATTCATACAAAATAACCATTA
TATTTAATCATCTAATAATTCTATCATCCATATTTATTATAACACACATACTAATCTAAACATATCAATTTACTATAAATAATAATATTTAAACA
TTAACTTATAACACATTTATAATATAATACTAATAATATAACCAAAAAATTCAAACATCCAATAATCCTTATAAACCAAACTTAGAGAAATATTA
TTCTAAATTATATAAAACCCAAACCCTATATTTATTACAAATCCAATAAATAATTATATCTCTCAATATTTAAATAAATTTCTTATTATTCAACC
AAACTTACAATTTACCATCTAACATTATAATAATAAACTAATATAATCATACATCAATAACATATCATATCATATACAAATATCTTTAATTTATA
ACAATCTTTACCTCAACTTTTACCTATAATAAATTAAAAATATTCTCATTCAAATACCTAATTTACTACACTATAATAATTATCCTCTACACCAT
TTCTCAATCTATACTCTAACTCACATTAAAATCTCATTTATACATACATATTTCACTTATCAAAACTCTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T15773 [Download] [View] Facility Assigned ID: cC-esflcLEL35I22d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence