EST details — SGN-E119824

Search information 
Request: SGN-E119824Match: SGN-E119824
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
No clone information found
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E119824Length: 366 bp (called/trimmed by facility)
Status: Legacy Direction:
>SGN-E119824 [clone name unknown] (called/trimmed by facility)
ACTAGACTAAGGATACACAGAAAGTCCATTCCATTAGAAATCTATTAGTACATGGGAGAGTTTTACAAGGGGTTTTTGGCTAATATACTATATGA
TAAATAGTACAATTTAATTAGGGAAAATGCCTTTAGGGATAATAACATCCCCAATGTTGTTGTGCCATGGGTCAACCAAATGAGTTGCCAAGTTC
TCCAATGGTCCTGGTCCTGGATATGCTGATTGGTGTACACAAAATCCCACAAATGCCAACAATGCAAGACGACCATTCTTGATTTCCTTGACTTT
GAGTTCTTCAAATTTAGCAGGGTCTTTAGAGTAGCCCAATGGGTCAAAAGCCCCACCAGGGTACTTCTTCTTTTCTGAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
No chromatogram information found for this sequence
Quality processing 
Processing information not available for this sequence