EST details — SGN-E137592

Search information 
Request: SGN-E137592Match: SGN-E137592
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C78718Clone name: cLES-6-I3
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179074 is on microarray TOM1: SGN-S1-1-1.1.2.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78718 [cLES-6-I3] Trace: SGN-T98388 EST: SGN-E286936 Direction: 5' Facility: TIGR
Clone: SGN-C179074 [TUS-30-M24] Trace: SGN-T184548 EST: SGN-E371934 Direction: 3' Facility: INRA
Clone: SGN-C179074 [TUS-30-M24] Trace: SGN-T184549 EST: SGN-E371935 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E137592Length: 416 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E137592 [] (called/trimmed by facility)
GGTTTTCAATGGCTTCGATATCTCTATTGTATGGTGCTTCTGGTGCATTGGGATATTTTGCTTTTGGTGAAGATACAAAGGATATAATTACGACG
AATCTTGGACAAGGATTACTTAGCAGCCTAGTTCAAATTGGTCTTTGCATAAACTTGTACTTTACTTTCCCTCTGATGATGAATCCAGTTTACGA
AGTAGTGGAAAGGAGGTTTTGTGAAGGGAGTTACTGTGTTTGGATAAGATGGATTATGGTTTTGGTAGAGACGTTTGTGGCATTGTTTGTGCCAG
ATTTTGCTGATTTCTTGTCATTGGTTGGGAGTAGTGTGTGCATAGTTATAGACTCTGTGTTGCCTGCCTTGATCCATCTGAGTGTGTTCAAAGAT
GAGCTAAGATGGCATGGTGTGGCTTGTGATGGTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T98388 [Download] [View] Facility Assigned ID: TPSAU50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence