EST details — SGN-E142359

Search information 
Request: SGN-E142359Match: SGN-E142359
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48292Clone name: cLEI-4-A5
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C48292 [cLEI-4-A5] Trace: SGN-T80160 EST: SGN-E267013 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E142359Length: 242 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E142359 [] (called/trimmed by facility)
CTGCGGCCCACTTTTGGAGCTGTTGGTCGAACGGGTGTTATGAGCATAGCTGAAAGCTTGGATAAAATAGGCCCTTTTTGTAGAAACTCTGCGGA
TTGTGTGACTATTCTGGATGCCATTCTGGGAAAGGACCCAGATGATGTTTCATCTACAGACATATCCTTTAGAGATCCATTCTCAGTTGATATGA
CAAGAGCTCACTGTTGGATATCTTGAGGATGCTGAGATGGAAGACGTGCACG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T80160 [Download] [View] Facility Assigned ID: TGSAM03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence