EST details — SGN-E150570

Search information 
Request: SGN-E150570Match: SGN-E150570
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C48844Clone name: cLEI-6-B24
cartOrder Clone
Library Name: cLEIOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: whole seedlings
Development Stage: germinating seed

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C48844 [cLEI-6-B24] Trace: SGN-T80785 EST: SGN-E265999 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E150570Length: 573 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E150570 [] (called/trimmed by facility)
CTTCGGAAGAGGCGTCGGGTAAATGTCCTTTCGGTGTGAATTTGAAATTTGAAGATTTCTAAATAAAAAAAGCAGCGAAAATGAGAGAATGCATA
TCGATCCACATTGGTCAGGCCGGTATTCAGGTCGGAAATGCATGCTGGGAACTTTACTGCCTTGAGCATGGCATTCAGCCTGATGGCCAGATGCC
AGGCGACAAGACAGTTGGAGGAGGTGATGATGCCTTCAACACCTTCTTCAGTGAAACTGGAGCTGGAAAGCATGTTCCCCGTGCTGTCTTTGTGG
ATCTTGAGCCTACTGTCATTGACGAAGTCAGGACAGGAACATACAGGCAGCTCTTTCACCCTGAGCAGCTCATCAGTGGCAAAGAAGATGCAGCC
AACAACTTTGCCCGTGGACATTATACAATTGGGAAGGAGATAGTTGATCTCTGCTTGGATCGTATCAAGAAGCTTGCTGATAACTGTACTGGTCT
TCAAGGTTTCCTGGGTTTCAATGCTGTAGGTGGTGGAACTGGTTCTGGTCTTGGTTACTTTTGCTGGAGCCGTCTCTATGTGGATTATGGAAAGA
AAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T80785 [Download] [View] Facility Assigned ID: TGSAX12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence