EST details — SGN-E156186

Search information 
Request: SGN-E156186Match: SGN-E156186
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C29723Clone name: cLEF-53-P14
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C29723 [cLEF-53-P14] Trace: SGN-T63288 EST: SGN-E245392 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E156186Length: 480 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E156186 [] (called/trimmed by facility)
ATGCTGCCGTCGCCGTTCTCTATCTCCGCCTATGAAATCTCTCACGTGCACTGCAGCTCTGCGTGTTTCTACTTCTCCGCCGTCTTTACGATCTT
CTCTCTTACCAAGTCTTCGACCTCTTCTTTATCGAGCTCGCCTCCGCAACAAGCTTAATCTGAGAAGATTGGGAAATGGAACTTGCCGGGCAGAG
TTTGCAAACGATGTGCCTTACGCCGCTGCTATTGGTGCTTGCATTTTGAGCTCGTGGGTTTTCCCGACTACTTACACGGAGGAGGACGATGGTGA
ATCCACAATTGATTCTGCTGATGCGAGGTTTGCTGTCATGGCAATTATCAGCTTCATTCCGTATTTTAATTGGATGAGTTGGGTTTTTGCGTGGT
TGGATACTGGGAAACCACGTTATGCAGTTTATGCTCTTGTGTATTTGGCTCCATATTTAAGCAACAACCTGTCTCTATCTCCTGAAGATAGCTTT
CTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T63288 [Download] [View] Facility Assigned ID: TMGID91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence