EST details — SGN-E161108

Search information 
Request: SGN-E161108Match: SGN-E161108
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93520Clone name: cLEX-14-O3
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93520 [cLEX-14-O3] Trace: SGN-T118055 EST: SGN-E305569 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E161108Length: 373 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E161108 [] (called/trimmed by facility)
GCTGGTTCGATGACAGATGATCAAGTCTTGGAAAAATCGATACTTTATGAAAGAGCAAACAGAGGAAACTTGAATGGTACTTACATTGTTGGGAG
TTCAGGATTTCCATTAACGGATTGGATTTTAGTTCCGTTTACTCATCAGAATGTTACATGGACACAACATGCTTTTAATGAGAAAGTGAATGATG
TTCAAAGAGTTGCCAAAGAAGCGTTTATGAGATTGAAAGCAAGATGGAGTTGTTTAAAGAAAAGAACAGAAGTGAAACTTCAAGATTTGCCTGTT
GTTCTTGGAGCTTGTTGTACACTTCACAATATCTGTGAGATTAGAGGTGAAGAATTACGTCAAAATCTTCAAATACTTTCACACCTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T118055 [Download] [View] Facility Assigned ID: TRXCA86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence