Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E172997

Search information 
Request: SGN-E172997Match: SGN-E172997
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C149157Clone name: cTOG-10-L9
nocartOrdering Not Available
Library Name: cTOGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: demethylated genomic sequence
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E172997Length: 659 bp (called/trimmed by facility)
Status: Legacy Direction: 5'
>SGN-E172997 [] (called/trimmed by facility)
AAACAACACGCTCACAATCACAAATAGAATAAATAACAACCATCTCACTCTCACGAGAATTAACATGAGATCCAACTAGTTCTAGAACAAGGTCG
TGGCCTGACATACCTCAACCAATTCAACATATATAACAAGAGAAAGGAAACCACTCTAAGCAAGCAGCGAAAAGAAGTACAACCCAAGAAATACC
TCCTCCACTCGAAGACACCACCAAAAAGAGGTACAAACACAACTAACCCCCACCTACGACAAACATAAATATCGAAGGTTCCAAAACTAACCAAT
GGATATGAACCTCATCATAGGTACAATTTTAATTGAAGCAAAACCCCACAACCTACACAATCTTACAGTATCCGCACTAGCAGAAAGAACCAAAC
TCGAGAACCACTCCCAAGAAGCTATAATATCGGAGGATAAATTGAAACTCATTCTAAGGCATTAGTCGCACCAACTACTAACAAGGTACGAAATT
ACGACTTTAAAAACATTAAAAATACAAAGCTAAGAGACAGGCAAATAATCTCCAACCTAAACTAAGGATTTCATAATTCTCACTATTCTAAGGTT
CAAGCGGGAATCAAGGAAATAAGGATAATAGAGATAATCCTAAATCTGCTACACACAATCAAAAGACAAGTAGATCGTAGCCTACCTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E172997] SGN-U106724 Lycopersicon esculentum demethylated Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T40526 [Download] [View] Facility Assigned ID: TDGBM65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence