Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E53346

Search information 
Request: SGN-E53346Match: SGN-E53346
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C70545Clone name: cLER-15-D12
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C70545 [cLER-15-D12] Trace: SGN-T95413 EST: SGN-E282893 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E53346Length: 648 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E53346 [] (called/trimmed by facility)
GGTTTTGCAAGCCCGGTCCAGAAGTAAACCGGTCGAAGAATTTTAATCCGGTTTAAGTCTTCCATTGCGGAGCAATCGACGGCGTTGTAATGACT
TCCGGCACGAGGCTACCGACATGGAAGGAGAGAGAGAATAATAAGCGGAGAGAGCGGCGGCGGAGGGCGATCGCCGCTAAGATCTTCGCCGGATT
AAGGATGTATGGTAACTATAAGCTACCGAAGCACTGTGATAATAACGAGGTATTGAAAGCTCTGTGTAAAGAGGCTGGTTGGATTGTTGAAGAAG
ATGGAACTACTTACAGAAAGGGATGCAAGCCAGTTACACGCATTGATATCGGTGGTTCTGTTTCTGTAAGCAGTTCATCTTACCAACTCAGCCCT
GGTGCTTCATATAATCCGAGTCCGGTTTCATCATCTATCCCTAGCCCGGTCTCATCCCATTATGTTGCCAATGTCCAAAATAATTCTGATCCGAA
CTCTCTTATTCCTTGGCTTAAGAACCTGTCATCTGGCTCATCACCATCCTTGTCTAATTTTCCCCATCATCTGTGCATTCCTGGAGGTTCTATAA
GTGCTTCTGTGACTCCACCTTTGAGCTCTCCCACTGCCAGTACTCCCAGGATGAATGATAATTGGGAAAATCCCACGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T95413 [Download] [View] Facility Assigned ID: TPRCH18THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence