EST details — SGN-E96837

Search information 
Request: SGN-E96837Match: SGN-E96837
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93901Clone name: cLEX-1-C24
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93901 [cLEX-1-C24] Trace: SGN-T115241 EST: SGN-E302658 Direction: 5' Facility: TIGR
Clone: SGN-C192062 [TUS-64-K4] Trace: SGN-T343903 EST: SGN-E543028 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192062 [TUS-64-K4] Trace: SGN-T343904 EST: SGN-E543029 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E96837Length: 634 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E96837 [] (called/trimmed by facility)
GGGAATGGAAATAGTAAAGTTAATAGGTACTCCTTTTAGTTTTTTCACATATAGAGTTATTTGGGCATTAAAGCTAAAGGGAATAAATTATGAGT
ATATAGATGAAGACATGTCCAAGAAAAGTTCTTTGCTTGTAAAATACAATCCAATTCACAAGAAAGTTCCAGTTCTAATCCATGGTGACAAGATA
ATTTGTGAGTCTATGGTCATCGTTGAATACATCAACGAGACGTGGAAACTGAATCCATTACTTTCAACTGATTCATATGAACGAGCCACATCTCG
ATTTTGGGCTAAATATATCGAAGAAAAGTCGCATAGTTCATGGAATGTATTTTGTTACACTGGAGAAAAGCAACAAAATGCTATAAAGGAGAGCC
TTGAAATGTTCAAAACCATAGAGGAAAATGCTTTGGGAGAAAACAATATATTATTTGGTGGTGAAAATATTGGATTTGTTGACATAGCTTTTGGA
GGTTATTCTCTTTGGATGGAAATTATTGAAGAAATTGTTGGGATTAAGTTACTTAATCCTCACAATTTTCCTCGTATTAACAATTGGATAAAAAA
ATTCAAAGAAGTTCAAACAATCAAAGATAATTTACCTAATCGTGATGAGATGTTTGTGTACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T115241 [Download] [View] Facility Assigned ID: TRXAB24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence