EST details — SGN-E98332

Search information 
Request: SGN-E98332Match: SGN-E98332
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C141505Clone name: cTOF-16-L19
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C141505 [cTOF-16-L19] Trace: SGN-T156925 EST: SGN-E344338 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E98332Length: 781 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E98332 [] (called/trimmed by facility)
AGGCAGCCTTCAACAATATTTAATACCATAAAATACTCAACACTTTTCTCTTAATATAAATCATGGCAGCTGCTGCAATGGCTCTTTCTTCCCCT
TCATTTGCTGGACAGGCAGTCAAACTCTCACCATCTGCCTCAGAAAATTCTGGAAATGGAAGGATCACTATGAGAAAGGCTGTCGCCAAGTCTGC
CCCATCTAGCAGCCCATGGTATGGCCCTGACCGTGTTAAGTACTTGGGACCATTCTCTGGTGAGTCCCCAAGCTACTTGACTGGCGAATTCCCTG
GTGACTACGGCTGGGATACCGCTGGACTTTCAGCTGACCCTGAGACCTTTGCCAAGAACCGTGAACTTGAGGTGATCCACTGCAGATGGGCTATG
CTTGGTGCTCTTGGATGTGTCTTTCCTGAGCTCTTGGCCCGCAACGGTGTAAAGTTTGGTGAGGCTGTGTGGTTCAAGGCCGGATCCCAGATCTT
CAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGGTCCATGCACAAAGCATCTTGGCCATCTGGGCTTGTCAAGTTGTGTTGATGGGAG
CCGTTGAAGGTTACCGCATTGCTGGTGGACCTCTTGGTGAGGTTGTCGACCCACTCTACCCCGGTGGCAGCTTCGACCCATTAGGCCTTGCTGAA
GACCCTTGAGCATTTGCCGAGCTCAAGGTAAAGGAGATTAAGAACGGCAGACTTGCTATGTTCTCGATGTTTGGATTCTTCGTTCAGCCATTGTT
ACCGGAAAGGGTCATTGAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T156925 [Download] [View] Facility Assigned ID: TOFCK70THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence