EST details — SGN-E98985

Search information 
Request: SGN-E98985Match: SGN-E98985
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C91292Clone name: cLEW-26-M15
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C91292 [cLEW-26-M15] Trace: SGN-T114825 EST: SGN-E302993 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E98985Length: 409 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E98985 [] (called/trimmed by facility)
TAGAAGATTTCATGTCGATATGTCTGGTTTTGCCTTCAATAGCACTATATTATGGGATCCAAAGAAATGGCATCGACCAACTTCAGATCCCATAC
GACAGTTGGACAATGTGAAGGAGGGTTTCCAAGAGACCACTTTCATAGAACAAATTGTTGAAGACGAAAGCCAAATGGAGGCTGTCCCTCCTGGT
TGCTCAAGGGTATGGAATTGGCACCTTCATTTGGAAGCTCACGGAGCTGTCTATCCAGGAGGCTGGCTGCTTCAAAAGAACCTTGATGCCATTAT
CTCTACCACATGAGAAACACAAGCAAGGTGCAGGAACTCTAAATGGTGTCCATGAAGGCCAGTGCTAATCCCAGTAGGAAGCTATCATTTTCAAG
CTGATCAGGGGAATTACTAGATTGCCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T114825 [Download] [View] Facility Assigned ID: TRDDW80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence