EST details — SGN-T25384

Search information 
Request: TCAAY49THMatch: SGN-T25384
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C14306Clone name: cLEC-7-I1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172931 is on microarray TOM1: SGN-S1-1-8.2.20.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172931 [TUS-14-N1] Trace: SGN-T196602 EST: SGN-E395276 Direction: 3' Facility: INRA
Clone: SGN-C172931 [TUS-14-N1] Trace: SGN-T196603 EST: SGN-E395277 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202102Length: 540 bp (749 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202102 [] (trimmed) CAGGGTTCATGGAGAGGTTACTAATCCTGAGGTTGACATGTTTGATAGAGAAAAGGTATTCATTGAAACGGTTCTAAGACCTTTGGTGCAGAAAT
TTCCACGATTGAAGGTCGTGATGGAGCATGTCACCACCATGGATGCTGTTAAGTTTGTTGAATCTTGCAGTGAAGGATTTGTTGCAGCGACTGTC
ACCCCACAACATCTTGTTTTAAACAGGAATTCTCTCTTCCAAGGGGGCTTACAACCGCATAATTACTGCCTTCCAGTCCTCAAAAGAGAGATCCA
CAGGGAGGCACTTGTGTCAGCTGTAACAAGTGGAAGTAAAAGATTTTTTCTTGGGACTGATAGTGCTCCTCATGATAGACGAAGAAAAGAATGTT
CTTGTGGATGTGCTGGTATTTACAATGCTCCTGTAGCCTTATCAGTATATGCAAAGGTGTTTGAAAAGGAAAATGCACTTGACAAGCTCGAAGCA
TTTACCAGCTTCAATGGACCAGACTTTTATGGGCTTCCGAGGAACAACTCAAAGATTAAGTTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202102] SGN-U582748 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25384 [Download] [View] Facility Assigned ID: TCAAY49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5