Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-T25071

Search information 
Request: TCABH65THMatch: SGN-T25071
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C14923Clone name: cLEC-9-K10
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C167663 [TUS-1-B13] Trace: SGN-T4 EST: SGN-E379466 Direction: 5' Facility: Avesthagen
Clone: SGN-C167663 [TUS-1-B13] Trace: SGN-T413 EST: SGN-E379363 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200777Length: 344 bp (423 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E200777 [] (trimmed) CGGAGAAGATGTTATCTTCTGAATACTGGACTTGGCAACGCAGAAGAACAAAGAGTCTTGAAGAGCTTTTGCATGTTGAAACTCCATCAACCCCT
GATGACTCTGATAATGATAAAATCGCTGGAATTGGGTTCAAGATGATAAGAATGGGGGAATCAGGTTGAAGCACTTCAAGACTGTTTCTTCAGTT
GAGTGGCATCGGAAGGGCGACTATTTCTCAACGCTTATGCCATCTGCCCAATCAAAAGCAGTGCTAATTCATATGCTCTCAAAGAAACAGACTCA
AAGAATACCATTCAAGCTTCATGGACTTCCAGTTTCAACAGCTTTCCATCCCTCTCGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200777] SGN-U586127 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25071 [Download] [View] Facility Assigned ID: TCABH65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5