EST details — SGN-T24769

Search information 
Request: TCABK25THMatch: SGN-T24769
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C957Clone name: cLEC-10-E1
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C186393 is on microarray TOM1: SGN-S1-1-2.2.5.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201182Length: 408 bp (874 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E201182 [] (trimmed) TTCGGCACGAGCACCAACCCTAAGAGGGTCGCCAAGGCAATTGCAGAGAAGACTTGCAATGCTCTTCTTCTCAAGGTTAACCAAATCGGTAGTGT
GACCGAGAGTATTGAAGCTGTGAAGATGTCCAAGAAGGCAGGTTGGGGTGTAATGACCAGTCACCGCAGTGGAGAAACAGAAGATACCTTCATTG
CTGATCTTGCTGTCGGTTTGTCAACGGGACAAATCAAGACTGGAGCTCCTTGCAGGTCAGAGCGTCTCGCCAAGTACAACCAGCTGTTGAGGATC
GAAGAGGAACTCGGATCAGAGGCTGTTTATGCAGGAGCAAGCTTCCGCAAGCCCGTTGAGCCCTACTAAATTTCAGCAGTTCCAAGTGTTGAGAT
TGTTGAGTTGTTGATCTGCCAAAAATAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201182] SGN-U579393 Tomato 200607 Build 2 318 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24769 [Download] [View] Facility Assigned ID: TCABK25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0220 Quality Trim Threshold: 14.5