EST details — SGN-T130425

Search information 
Request: TFBAA28THCMatch: SGN-T130425
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C119509Clone name: cTOB-1-E7
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: Alias clone SGN-C182899 is on microarray TOM1: SGN-S1-1-8.1.5.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E314456Length: 614 bp (873 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E314456 [] (trimmed) GATTACATTGCTCAACTATAAACCCTAGAAGAAATGTTGAGAAGAAGAATCACTTCACTACTATCATCGTCTTCACTCCAAAATGTTCCAATCTA
CGGCGAACCCATCAAGATTTCTCAACCCATATTCACATCTTCACAAAAGTTACCACTTTTGCAATTCTCTCAACGCCCCATCTCCAGCATTGGAT
CATTGGGGTGTCAGTTTCGCAGAGCTTACAGTCTTCTGAGCCTAAATGATTTGCAAGATAACAAAGGTGCTAGGAAGCAGAAGACTCGGAAGGGA
AGAGGTATTGGGTCTGGTAAAGGGAAGACGGCGGGTCGTGGACATAAGGGTCAGAAAGCTAGAGGGACGTATAAGTTCGGGTTTGAAGGTGGACA
GACCCCACTTCGTCGCCGTGTGCCTAAACGTGGATTTAAGAACCCGTTCAGTCTCACATTTCAGCCAGTTGGGTTGGGAAAGATTGCAAATCTGA
TAAATGCTGGGAAGATTGACTCGTCAGAGTTGATCACAATGAAAACTCTAAAGGATTCCGGTGCAATAGGGAAGCAAATAGAAGATGGAGCCAGG
TTGATGGGGCGTGGGGCTGAACTTATTCAATGGCCCATCCATCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E314456] SGN-U583446 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T130425 [Download] [View] Facility Assigned ID: TFBAA28THC
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5