EST details — SGN-T130619

Search information 
Request: TFBAT44THMatch: SGN-T130619
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C122713Clone name: cTOB-5-H16
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E316738Length: 574 bp (932 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E316738 [] (trimmed) GCACAAACCTTATTGATGAGAAAAGTATCTTTGTTGGTGGTATATTTCCAGACCCCTCCGGAGAGAAATTCGAGAACTATTTAACGCTAGCTGAA
AAACTGCGAGGCGAGTTCGATTTTGCTCACACTGTTGATGCTAAACACCTCCCTCGGGGTGGACCAGTCAACAAGCCCACTCTTCGTCTTCTAAA
GCCATTTGATGAACTCTTTGTTGATTTTGAGGACTTTGATGTCGATGCAATGGAGAAGTTCATCTCAGAATCTAGTATTCCTGTTGTTACTATTT
TTGACAATGACCCAAACAACCATCCTTATGTTAACAAGTTCTTCGAAGGCACCAACGCCAAGGCATTGCTATTTGTGAACTTTAGCTCTGAATTT
GATGCTTTTAAGTCCAAGTACAACGATGTTGCTGTGATTTACAAAGGGGATGGGGTGAGCTTTCTCTTGGGTGATGTTGACGCTGGTCAAGGTGC
TTTTGAGTACTTCGGACTGAAGCCGGAACAGGCACCTGTGATCATCATAATGGACGCTGATGAACAAAAGTATATTAAGGACCATGTGGAACCTG
ATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E316738] SGN-U575297 Tomato 200607 Build 2 179 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T130619 [Download] [View] Facility Assigned ID: TFBAT44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5