EST details — SGN-T130735

Search information 
Request: TFBBA94THMatch: SGN-T130735
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C122887Clone name: cTOB-7-P19
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E316651Length: 432 bp (796 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E316651 [] (trimmed) GGTAAAGAAAAAATGGCATGTATGTCACTCAATATAGGAGCTGCTTCTGCTTTGAAGTTTGTAAGCAATTCCCAAAATCATCCAGTAAAGCTGTT
CTCGGCTAAAGAACAACGTTGTTCCAACTTCAGTTCCAGCAATTGGGGTTGTTTCAGTCTTCGAGTTCGTCGGAGTTCTTGCCTTCGTTTTGATA
CACAAAAATCTTTCGCCGTTTTCAACAGCCTTCCAGTGGATAATAGCAACCCCAAAGAAAGTGTGGTTGTCTTGGTAATTGGAGGAGGTGGGAGA
GAGCATGCGCTTTGTCATGCTTTGAGGCGATCCCCTTCTTGTGACGCTATTTTCTGTGCACCGGGTAATGCTGGAATTTCCAGCTCAGGTGATGC
GACTTGTATATCAGACCTTGATGTTTTAGATAGTTCAACTGTGATTGCTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E316651] SGN-U564731 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T130735 [Download] [View] Facility Assigned ID: TFBBA94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0134 Quality Trim Threshold: 14.5