EST details — SGN-T130811

Search information 
Request: TFBBD02THMatch: SGN-T130811
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C122900Clone name: cTOB-8-A4
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E317608Length: 458 bp (780 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E317608 [] (trimmed) GCTCTTAAGCATTACTTGAGATTTGAGAATTTCCCATTCTATTCCATTATTTTTTGAGACATCAAATCTCCTGTTCCTTAGAATTTCAAATTATT
TATCAATGGATTTGAGACGATCATCTCGTTGTTGTTATCTCTTTGCCATATTTATTCTTGCCATTGCTGTCTGGTTTTCTCCATCTGCAGCTTCC
ATCGCTGGCAAAGATATTAATCCTCCATATCCTAAAGCTATTTCTGACTTGAAGGAGTCAATTGTGAAGGGTTTAGGTTTTCAAGCGGAGGATTT
CAAGATATCTGGGTTTGATTTGAAAGATGCTCTTGTGGGTAGGTCGGTGTCTTATGAGTTTGATGTGGAAGTTGATAATAAAGGAATTCCCTTAA
AGCTTTTGGAGGATGTGAATAAATGGGAATTTGTAGATTTGCCTATTTTTCGGGTAGAGAAAGGTGAAGAAAATGGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E317608] SGN-U584853 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T130811 [Download] [View] Facility Assigned ID: TFBBD02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.926 Expected Error Rate: 0.0149 Quality Trim Threshold: 14.5